• RSS
  • Twitter
  • FaceBook

Security Forums

Log in

FAQ | Search | Usergroups | Profile | Register | RSS | Posting Guidelines | Recent Posts

UNIX: Count poly A. Awk and sed are recommanded...

Users browsing this topic:0 Security Fans, 0 Stealth Security Fans
Registered Security Fans: None
Post new topic   Reply to topic   Printer-friendly version    Networking/Security Forums Index -> UNIX // GNU/Linux

View previous topic :: View next topic  
Author Message
patrick chia
Just Arrived
Just Arrived


Joined: 29 Jan 2009
Posts: 0
Location: Malaysia

Offline

PostPosted: Mon Feb 16, 2009 6:56 am    Post subject: UNIX: Count poly A. Awk and sed are recommanded... Reply with quote

My input:
AAAAATTTTGGGCCC
AAAAAATT
AAAAAAACCCCCCA
AAAAAAAATTTTTGGGGGCCCCC

My output:
AAAAA = 1
AAAAAA = 1
AAAAAAA = 1
AAAAAAAA = 1

Actually I got use the grep command line to find out the poly A in my input sequence.
The command line I used is:
grep 'AAAAA' inputfiles | wc -l
grep 'AAAAAA' inputfiles | wc -l
grep 'AAAAAAA' inputfiles | wc -l
grep 'AAAAAAAA' inputfiles | wc -l

My senior got advise me to use awk or sed. Any UNIX expert have the idea about use the awk or sed to find out the poly A in my input file? Thanks for all of your advise. Have a nice day.
Back to top
View user's profile Send private message MSN Messenger
Display posts from previous:   

Post new topic   Reply to topic   Printer-friendly version    Networking/Security Forums Index -> UNIX // GNU/Linux All times are GMT + 2 Hours
Page 1 of 1


 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum

Community Area

Log in | Register